return to tranceaddict TranceAddict Forums Archive > Main Forums > Chill Out Room

Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13 [14] 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 
God (pg. 14)
View this Thread in Original format
yukii
quote:
Originally posted by netroM
yukii:
"This man studied how moths changed their phenotype, not because it benefits their species, but because all the white moths sitting against dark trees were susceptible to being eaten by birds."
How does that not benefit the species? Changing colour so the species can live on, I mean.


Right, but I'm saying there will be NO mutation for the benefit of a species.. Do you understand? It just so happened to be that one moth was black and could camouflage itself while the other white moths were eaten- he was the one that was able to pass his genes.. just by chance.. Do you get it now? Like, the whole point of this observation was to see the inefficiency (or sometimes beneficial) and randomness of mutations.
yukii
quote:
Originally posted by Saka
"Mathematicians agree that any requisite number beyond 10(50) has, statistically, a zero probability of occurrence.
I.L Cohen

"This means that 10(89190) DNA molecules, on average, must form to provide the one chance of forming the specific DNA sequence necessary to code 124 proteins. 10(89190) DNAs would weigh 10(89147) more than the earth ... A quantity of DNA this colossal could never have been formed.

R.L. Wysong


I have already heard of this statement before, for a while it was a very legit statement.. Just FYI- it has been disproved already ;) The probability is not zero, if that were true we wouldn't be here discussing this.
Also, I worked in a evolutionary genetics lab, let me tell you all you need for DNA to replicate (in other words- you're creating DNA):

- DI Water
- Mg 2+
- Buffer solution
- dNTPS
- forward primer
- reverse primer
- taq (or supertaq if the DNA is very degenerated)

Thats it!! (Sorry if i missed anything, im recalling from memory)
Fledz
quote:
Originally posted by yukii
Right, but I'm saying there will be NO mutation for the benefit of a species.. Do you understand? It just so happened to be that one moth was black and could camouflage itself while the other white moths were eaten- he was the one that was able to pass his genes.. just by chance.. Do you get it now? Like, the whole point of this observation was to see the inefficiency (or sometimes beneficial) and randomness of mutations.

It wasn't one moth. It was countless moths, but still a minority amongst the local moth population.

Genetic advantage doesn't in most cases stem from one organism, but many.
yukii
quote:
Originally posted by Fledz
It wasn't one moth. It was countless moths, but still a minority amongst the local moth population.

Genetic advantage doesn't in most cases stem from one organism, but many.


I was oversimplifying it for the sake of explaining the theory. Of course, there will be a minority of moths, but the only reason they prevail will be because they are NOT being eaten = they pass their genes.
LiquidX
I haven't browsed the whole thread, but I hope it has been discussed that not all Religious Christians discard evolution, in fact many embrace it and make a number of connections of Evolution and the creation of God. For those who believe in the Bible, much of the language in it is symbolism, many paraboles for the wise to understand .. anyways, that might start a discussion on it's own ( if it hasn't already ).. anyways, thought I'd just jump in and kind of clear that "generalizing" if it hasn't already. We don't want ignorant comments to come off equally dumb as those of Glenn Beck's.
yukii
quote:
Originally posted by Saka
The probability that everything has happened the way its believed to have happened.
It's impossible.


It is not impossible. In fact, with the millions of earth-like planets within galaxies out of millions of galaxies in the universe- the probability of life existing is pretty much above zero. All the chemicals we need to create life are HERE. The basic life elements are Carbon, Hydrogen, Oxygen, and Nitrogen. What IS DNA? Deoxyribonucleic Acid. Ok, let's take it a step further and break it down.. The double helix is composed of a molecule of sugar, phosphoric acid, a base. The bases are A, T, G, and C. Which is what you see when you have sequenced DNA and process it on the computer and all you see is: AAATCTTGACTAACTGTATGAC (and sometimes R for ambiguous bases) and U (uracil if you are sequencing RNA). The chemicals Adenine, Thymine, Guanine, and Cytosine are all held together be hydrogen bonding. Look up these bases if you like, they are all very simple molecules you can learn about in organic chem.
Honestly if you ask me, none of this seems far fetched.

quote:
Originally posted by Saka
And my insight on adaptation has come from studies at high school, concerning moths and grazing mammals, but evolution doesn't stem from animals adapting to an environment.


You're right. Evolution doesn't happen by animals adapting to an environment. But those who survive, pass their genes. Evolution is very random and a single mutation can change the entire outcome of a species. I don't see where you were going with that sentence.
Spam
quote:
Originally posted by yukii
I was oversimplifying it for the sake of explaining the theory. Of course, there will be a minority of moths, but the only reason they prevail will be because they are NOT being eaten = they pass their genes.


I think it's important to note the difference between the idea that "creatures evolve so that they can survive", vs "creatures mutate randomly, and sometimes it allows them to survive". Thank you for that.
MrJiveBoJingles
Yeah, "adaptation" is a term we apply after the fact. In most cases it doesn't have much to do with any action on the part of the animal that managed to survive.
Moongoose
God damn it you guys, why am i always absent when you start picking on creationists :mad: The past few hours, spent rubbing against some hot blondes to the sound of some great old music now seem totaly wasted when i could have been here instead :mad:
yukii
Also: Stanley Miller conducted experiments that showed nucleotides & amino acids could form in a primitive-earth environment from abiotic factors.

http://en.wikipedia.org/wiki/Stanley_Miller

Hope this helps with your interpretation of evolution being simply impossible Saka. I will be waiting for your response.

MrJiveBoJingles
quote:
Originally posted by yukii
Also: Stanley Miller conducted experiments that showed nucleotides & amino acids could form in a primitive-earth environment from abiotic factors.

http://en.wikipedia.org/wiki/Stanley_Miller

Hope this helps with your interpretation of evolution being simply impossible.

This has already been mentioned. :p
Moongoose
quote:
Originally posted by yukii

You're right. Evolution doesn't happen by animals adapting to an environment. But those who survive, pass their genes. Evolution is very random and a single mutation can change the entire outcome of a species. I don't see where you were going with that sentence.



Can i just point out one thing? Be careful of using the word random around people who dont understand evolution especially without putting it in proper context. That is, its fine in the phrase "random mutations" but it shouldnt really appear anywhere else as it just tends to confuse them.
CLICK TO RETURN TO TOP OF PAGE
Pages: 1 2 3 4 5 6 7 8 9 10 11 12 13 [14] 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 
Privacy Statement